Journal: Cancer research

Article Title: Microenvironment-driven dynamic chromatin changes in glioblastoma recapitulate early neural development at single-cell resolution

doi: 10.1158/0008-5472.CAN-22-2872

Figure Lengend Snippet: RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FRA1 (D80B4) Rabbit mAb Cell Signaling Cat #5281 Anti-β-Actin antibody SIGMA A2228 CD44 coupled to APC Miltenyi Biotec #130-113-338 Plasmids pLIX-FOSL1 This study - Primers qPCR: FOSL1_F ( 26 ) CGAAGGCCTTGTGAACAGA qPCR: FOSL1_R ( 26 ) GTTCCTTCCTCCGGTTCCT qPCR:DLX5_F ( 10 ) GTCTTCAGCTACCGATTCTGAC qPCR:DLX5_R ( 10 ) CTTTGCCATAGGAAGCCGAG Chemicals, Peptides, and Recombinant Proteins ROCK inhibitor (Y-27632 2HCl) Selleck Chemicals Cat# S1049 Matrigel Corning #354277 Critical Commercial Assays Papain Dissociation System Worthington Biochemical LK003150 Experimental Models: Cell Lines Patient-Derived Glioma Stem Cells: GSC-320, GSC-607, GSC-728, GSC-810, GSC-1206 National Institutes of Health and Weill Cornell Medicine/NYU Presbyterian Hospital N/A NIH-registered human H1 (WA01) embryonic stem cells WiCell Research Institute Cat# WA01; RRID: CVCL_9771 NIH-registered human H9 (WA09) embryonic stem cells WiCell Research Institute Cat# WA09; RRID: CVCL_9773 Critical commercial assays ATAC-seq NextGEM kit 10X Genomics PN: 1000175 Single Cell Multiome ATAC + Gene Expression kit 10X Genomics PN: 1000285 Deposited data scATAC-seq and multiome data This study PRJNA819057 Software and algorithms Genome assembly https://www.ncbi.nlm.nih.gov/grc/human hg38 / GRCh38 CellRanger 10X Genomics CellRanger v6.0.1 CellRanger-ATAC 10X Genomics CellRanger-ATAC v1.1.0 CellRanger-ARC 10X Genomics CellRanger-ARC v2.0.0 ArchR ( 16 ) ArchR v1.0.1 scanpy ( 23 ) scanpy v1.7.2 MACS2 ( 17 ) macs2 v2.1.2 DESeq2 ( 19 ) DESeq2 v_1.26.0 Palantir ( 24 ) Palantir v0.2.6 Fiji NIH https://imagej.net/software/fiji/ GraphPad Prism 8 GraphPad RRID: SCR_000306 Open in a separate window RESOURCES TABLE.

Techniques: Recombinant, Expressing, Software

Journal: Journal of Cellular and Molecular Medicine

Article Title: DC‐CIK cells derived from ovarian cancer patient menstrual blood activate the TNFR1‐ASK1‐AIP1 pathway to kill autologous ovarian cancer stem cells

doi: 10.1111/jcmm.13611

Figure Lengend Snippet: Induction of OCPMB‐derived mononuclear cells in vitro to differentiate into DC and CIK cells. A, FACS detection results showed that stimulated mononuclear cells significantly expressed high levels of the CIK markers CD3 and CD56. ** P < .01 vs before induction; n = 6; B, FACS detection results showed that stimulated mononuclear cells significantly expressed high levels of the CIK makers CD3 and CD8. ** P < .01 vs before induction; n = 6; C, The FACS detection results showed that the stimulated mononuclear cells significantly expressed high levels of the DC markers CD1a and CD83. ** P < .01 vs before induction; n = 6; D, Immunofluorescence staining results showed that the enriched CD44+/CD133+ OCSCs expressed high levels of TNFR1 protein. Scale bar = 30 μm; E, The FACS detection results showed that the positive TNFR1 protein detection rate among the enriched CD44+/CD133+ OCSCs reached approximately 74.41%

Article Snippet: The cell precipitates were collected and incubated with mouse anti‐human CD133‐FITC antibodies and rabbit anti‐human CD44‐APC antibodies (e‐Bioscience Inc., San Diego, CA, USA) in vitro at 4°C for 30 minutes.

Techniques: Derivative Assay, In Vitro, Immunofluorescence, Staining

Journal: Journal of Cellular and Molecular Medicine

Article Title: DC‐CIK cells derived from ovarian cancer patient menstrual blood activate the TNFR1‐ASK1‐AIP1 pathway to kill autologous ovarian cancer stem cells

doi: 10.1111/jcmm.13611

Figure Lengend Snippet: OCPMB‐derived DC‐CIK cells significantly killed CD44+/CD133+ OCSCs. A, The cytotoxicity experiment results showed that the OCSC killing rates of CIK and the OCSC killing rate of DC‐CIK cells were both significantly higher than those in the simple OCSC group and the DC‐OCSC group at the 10:1 and 50:1 ratios; B, DC‐CIK cells and OCSCs were mixed at a ratio of 10:1 and cultured in vitro for 24 h. FACS results of Annexin V/PI staining showed that the total apoptosis rate in the DC‐CIK‐OCSC group was significantly higher than in the simple OCSC group and the DC‐OSCS group; C, The transwell invasion experiment results suggested that the number of migrated cells in the DC‐CIK‐OCSC group was significantly lower than those in the simple OCSC group and the DC‐OCSC group. Scale bar = 30 μm

Article Snippet: The cell precipitates were collected and incubated with mouse anti‐human CD133‐FITC antibodies and rabbit anti‐human CD44‐APC antibodies (e‐Bioscience Inc., San Diego, CA, USA) in vitro at 4°C for 30 minutes.

Techniques: Derivative Assay, Cell Culture, In Vitro, Staining

Journal: Journal of Cellular and Molecular Medicine

Article Title: DC‐CIK cells derived from ovarian cancer patient menstrual blood activate the TNFR1‐ASK1‐AIP1 pathway to kill autologous ovarian cancer stem cells

doi: 10.1111/jcmm.13611

Figure Lengend Snippet: OCPMB‐derived DC‐CIK cells significantly inhibited the growth of CD44+/CD133+ OCSCs in nude mice. A, DC or DC‐CIK cells were mixed with OCSCs at a ratio of 10:1 and cultured in vitro for 24 h. The cells were collected and subcutaneously injected into nude mice. After 5 mo, tumour tissues derived from each group of cells were isolated; B, The volume of tumour tissues in the DC‐CIK‐OCSC group was significantly smaller than those in the simple OCSC group and the DC‐OCSC group. ** P < .01 vs OCSCs; n = 6; C, The weight of tumour tissues in the DC‐CIK‐OCSC group was significantly lower than those in the simple OCSC group and the DC‐OCSC group. ** P < .01 vs OCSCs; n = 6; D, The HE staining results showed that tumours in all groups met the characteristics of mixed‐type epithelial ovarian cancer. The tumour tissues in the DC‐CIK‐OCSC group had more necrotic cells, significantly reduced numbers of tumour cells and significantly reduced malignancy. Scale bar = 30 μm; E, The immunofluorescence staining results showed that the number of Ki67‐positive cells in tumour tissues from the DC‐CIK‐OCSC group was significantly lower than those in the other 2 groups, whereas the number of ASK1‐positive cells was significantly higher than those in the other 2 groups. Scale bar = 30 μm; F, The Western blot results suggested that the expression levels of TNF‐α, TNFR1 and ASK1 in tumour tissues in the DC‐CIK‐OCSC group were significantly higher than those in other groups, whereas the expression level of p‐ASK1 protein was significantly lower than those in other groups

Article Snippet: The cell precipitates were collected and incubated with mouse anti‐human CD133‐FITC antibodies and rabbit anti‐human CD44‐APC antibodies (e‐Bioscience Inc., San Diego, CA, USA) in vitro at 4°C for 30 minutes.

Techniques: Derivative Assay, Cell Culture, In Vitro, Injection, Isolation, Staining, Immunofluorescence, Western Blot, Expressing